Loading...
Home / Health / Ribosomes

Ribosomes 84

The copy of the genetic code is exported outside of the cell nucleus. It is then read by the cell’s protein factories, the ribosomes. Ribosomes read the sentence (the copy of the gene) from beginning to end. And they will do so in three-letter packets. If a sentence is made, for example, of AUGGUGCACCUGACUCCUGAGGAGAAG, the ribosomes will read AUG, GUG, CAC, CUG, ACU, CCU, GAG, GAG, AAG.

You can find out how to build a specific protein within the copy of a gene. Since there are 20 different amino acids, any given group of three letters must represent a specific amino acid. GUC, for example, corresponds to “valine”, and CAC to “histidine“. The decoder which enables the cell to translate the three-letter words into amino acids is called the genetic code. When ribosomes read a sentence in three-letter packets, they know exactly which of the twenty amino acids is assigned to each three-letter word and in which order. Ribosomes assemble amino acids one after another in order to finally obtain the completed protein. The result is a new protein: the one which had been “ordered“. Any sequencing error or wrong amino acid would render the protein useless. That is why such mistakes are practically never made. Once production is complete, the protein leaves the ribosome to go carry out its mission. It will be allowed to leave the cell, and will once more undergo security tests.

Share

Leave a Reply

Your email address will not be published. Required fields are marked *